View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_low_69 (Length: 322)
Name: NF0953_low_69
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0953_low_69 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 13 - 313
Target Start/End: Original strand, 42113350 - 42113650
Alignment:
Q |
13 |
gttcatgaatactgtatcaccaatccttacttcagctttcgacctcaccaccgtaacattaatctcctccttaatagtcctctctgttttatctctttgt |
112 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
T |
42113350 |
gttcatgaatactttatcaccaatccttacttcagctttcgacctcaccaccgtaacattaatctcttccttaattgtcctctctgttttatctctttgt |
42113449 |
T |
 |
Q |
113 |
tttattttccatctccgtttgaaatcaaaatctttaacctatcttcaaggctttaactctctttggaccgtacgtttcctcctcgtacttttcatcttct |
212 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42113450 |
tttattttccatctccgtttgaaatcaaaatctttaacctatcttcaaggctttaactctctttggaccgtacgtttcctcctcgtacttttcatcttct |
42113549 |
T |
 |
Q |
213 |
tctggtgcatcattgaacttttccggttaccttttttccggagaaaatatctatatccactttcaccctctctagatattactcaacaagccaatctctg |
312 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
42113550 |
tctggtgcatcattgaacttttccggttaccttttttccggagaaaatatctatatccactttcaccctccctagatattactcaacaagccaatctctg |
42113649 |
T |
 |
Q |
313 |
c |
313 |
Q |
|
|
| |
|
|
T |
42113650 |
c |
42113650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University