View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_low_70 (Length: 316)
Name: NF0953_low_70
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0953_low_70 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 2e-46; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 94 - 220
Target Start/End: Complemental strand, 5394455 - 5394329
Alignment:
| Q |
94 |
gatgaaagatatgggtggtgtgtgggaagagattgtgagggaaaatgggttattgcacacaaagcttgaagaagttggagattggtggtttgcagatttt |
193 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||| |||| || ||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5394455 |
gatgaaggataagggtggtgtgtgggaagagattgtgagggagaatgaattgttgtacaccaagcttgaagaagttggagattggtggtttgcagatttt |
5394356 |
T |
|
| Q |
194 |
agtttgagactggagggtgtgttggat |
220 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5394355 |
agtttgagactggagggtgtgttggat |
5394329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 94 - 220
Target Start/End: Complemental strand, 5390917 - 5390791
Alignment:
| Q |
94 |
gatgaaagatatgggtggtgtgtgggaagagattgtgagggaaaatgggttattgcacacaaagcttgaagaagttggagattggtggtttgcagatttt |
193 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||| |||| || ||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5390917 |
gatgaaggataagggtggtgtgtgggaagagattgtgagggagaatgaattgttgtacaccaagcttgaagaagttggagattggtggtttgcagatttt |
5390818 |
T |
|
| Q |
194 |
agtttgagactggagggtgtgttggat |
220 |
Q |
| |
|
| || ||| ||||||||||||||||| |
|
|
| T |
5390817 |
atgtttagagtggagggtgtgttggat |
5390791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 94 - 220
Target Start/End: Complemental strand, 5399636 - 5399510
Alignment:
| Q |
94 |
gatgaaagatatgggtggtgtgtgggaagagattgtgagggaaaatgggttattgcacacaaagcttgaagaagttggagattggtggtttgcagatttt |
193 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||| |||| || ||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5399636 |
gatgaaggataagggtggtgtgtgggaagagattgtgagggagaatgaattgttgtacaccaagcttgaagaagttggagattggtggtttgcagatttt |
5399537 |
T |
|
| Q |
194 |
agtttgagactggagggtgtgttggat |
220 |
Q |
| |
|
| || ||| ||||||||||||||||| |
|
|
| T |
5399536 |
atgtttagagtggagggtgtgttggat |
5399510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University