View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_low_77 (Length: 278)
Name: NF0953_low_77
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0953_low_77 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 31 - 269
Target Start/End: Original strand, 24491758 - 24491991
Alignment:
| Q |
31 |
tttggatcatggctcagctcatcatccctctttacctaatcaacaagcatatcatgcttcttaagttcgttataactaacttgctccttttgtattggct |
130 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24491758 |
tttggatcatggctcagctcat---ccctctttacctaatcaacaagcatatcatgcttcttaagttcgttataactaacttgctccttttgtattggct |
24491854 |
T |
|
| Q |
131 |
atatatataaagccttgtgatgagtagatttaagagagttaagtggatgaattctgatcaaactttttagctagaattgagtgtgcacatatcaggagat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24491855 |
atatatataaagccttgtgatgagtagatttaagggagttaagtggatgaattctgatcaaactttttagctagaattga--gtgcacatatcaggagac |
24491952 |
T |
|
| Q |
231 |
gaaaattcaatttctgagagatggcattgctatattctt |
269 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
24491953 |
gaaaattcaatttgtgagagatggcattgctagattctt |
24491991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University