View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_low_92 (Length: 252)
Name: NF0953_low_92
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0953_low_92 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 50511291 - 50511365
Alignment:
Q |
1 |
taatgtgtgtgaatattgtacactctcaaatactgaatttcattcttaaaaactagagtactagctagctaagag |
75 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50511291 |
taatgtgtgtgaatattgtacactctcaaatactgaatttcattcttaaaaactagagtactagctagctaagag |
50511365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 147 - 223
Target Start/End: Original strand, 50511437 - 50511512
Alignment:
Q |
147 |
cccaaaacaagtagagcataattccactatcctcttgtttggacgtttactttggtggaagaagaaatacctcaaat |
223 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
50511437 |
cccaaaacaagtagagcataattccactatcctcttgtttggacg-ttactttggtggaagaagaaatacctcaaat |
50511512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University