View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_low_95 (Length: 251)
Name: NF0953_low_95
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0953_low_95 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 23896165 - 23895944
Alignment:
| Q |
1 |
acaaagtagtgaatgatgacttctcccacatgagtttgnnnnnnnnnnntggatagaagagaaggattggggacaaagccacacgagggagtaaaataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23896165 |
acaaagtagtgaatgatgacttctcccacatgagtttgaaaaaaaaaa-tggatagaagagaaggattggggacaaagccacacgagggagtaaaataat |
23896067 |
T |
|
| Q |
101 |
tgagtaaaccatcatcatttcgttcgctcaccatgtgtatgagaaggtatgattgttttttaacctagggtcttaactagtgttttggaggcactaatta |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
23896066 |
tgagtaagccatcatcatttcgttcgctcaccatgtgtatgagaaggtatgattgttttttaacctagggtcttaactagtgttttggaggtactggtta |
23895967 |
T |
|
| Q |
201 |
acattttcttttaatgtatttgt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
23895966 |
acattttcttttaatgtatttgt |
23895944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University