View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0954_high_11 (Length: 301)
Name: NF0954_high_11
Description: NF0954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0954_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 3e-51; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 30 - 144
Target Start/End: Original strand, 2472288 - 2472402
Alignment:
| Q |
30 |
cttctttcattgtagaaaaaatttattgtgaaaatgtggctagttgtccacgccttatgtatccttttgtttataagtgccttgacaacacatgtgtaaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
2472288 |
cttctttcattgtagaaaaaatttattgtgaaaatgcggctagttgtccacgccttatgtatcctttagtttataagtgccttgacaacaaatgtgtaaa |
2472387 |
T |
 |
| Q |
130 |
gtttatgatgaagtc |
144 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2472388 |
gtttatgatgaagtc |
2472402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 143 - 294
Target Start/End: Original strand, 2472426 - 2472577
Alignment:
| Q |
143 |
tcgcgcccaagagggtacacaaacgccatgcaaggaggagtgagtccttgcactagcnnnnnnntctatgcaacataccttattgtcgtaccgcgagttg |
242 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||| |
|
|
| T |
2472426 |
tcgcgcccaagacggtacacaaacgccatgcaaggaggagtgagtccttgcactagcaaaaaaatctatgcaacataccttattgttgtaccgcgtgttg |
2472525 |
T |
 |
| Q |
243 |
ccatttaaannnnnnnactagcatccaataattgtatcttttatattcttcg |
294 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2472526 |
ccatttaattttttttactagcatccaataattgtatcttttatatttttcg |
2472577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 146 - 286
Target Start/End: Complemental strand, 4734641 - 4734503
Alignment:
| Q |
146 |
cgcccaagagggtacacaaacgccatgcaaggaggagtgagtccttgcactagcnnnnnnntctatgcaacataccttattgtcgtaccgcgagttgcca |
245 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| || ||||| ||||||||| |
|
|
| T |
4734641 |
cgccgaagagggtacacaaacgccatgcaaggaggagtgagttcttgcactagc-aaaaaatctatgcaacataccttatagttataccgtgagttgcca |
4734543 |
T |
 |
| Q |
246 |
tttaaannnnnnnactagcatccaataattgtatcttttat |
286 |
Q |
| |
|
||| || | |||||||||||||||||||||||||| |
|
|
| T |
4734542 |
ttt-aatctttttagtagcatccaataattgtatcttttat |
4734503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 153 - 285
Target Start/End: Complemental strand, 38359539 - 38359410
Alignment:
| Q |
153 |
gagggtacacaaacgccatgcaaggaggagtgagtccttgcactagcnnnnnnntctatgcaacataccttattgtcgtaccgcgagttgccatttaaan |
252 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||| ||||||||||| ||||||||| ||||||| |||| | ||||||||||||||||| |
|
|
| T |
38359539 |
gagggtacacaaacgtcgtgcaaggaggagtgagttcttgcactagc-aaaaaatctatgcaatataccttgttgttacatcgcgagttgccatttaa-- |
38359443 |
T |
 |
| Q |
253 |
nnnnnnactagcatccaataattgtatctttta |
285 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
38359442 |
ttttttactagcatccaataattgtatctttta |
38359410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 199
Target Start/End: Original strand, 38316020 - 38316058
Alignment:
| Q |
161 |
acaaacgccatgcaaggaggagtgagtccttgcactagc |
199 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38316020 |
acaaacgccatgcaaggaggagtgagttcttgcactagc |
38316058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University