View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0954_low_23 (Length: 351)
Name: NF0954_low_23
Description: NF0954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0954_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 53 - 225
Target Start/End: Original strand, 42453863 - 42454035
Alignment:
| Q |
53 |
tgataatagggattgtggctttggctgttcctttccgatatcttgtctttgtttggtttctttattttctaaggcatccaatgttccgttcaccttttcc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42453863 |
tgataatagggattgtggctttggctgttcctttccgatatcttgtctttgtttggtttctttattttctaaggcatccaatgttccgttcaccttttcc |
42453962 |
T |
|
| Q |
153 |
tccattttatgaaaattggattcgaaggatgccttcaaaattagatagcatgatatgaaaatgcagccctatg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42453963 |
tccattttatgaaaattggattcgaaggatgccttcaaaattagatagcatgatatgaaaatgcagctctatg |
42454035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University