View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0954_low_24 (Length: 345)
Name: NF0954_low_24
Description: NF0954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0954_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 2e-86; HSPs: 13)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 79 - 252
Target Start/End: Complemental strand, 23391521 - 23391348
Alignment:
Q |
79 |
gaaaagaaacttaaatgaatgggtgtgtgaaatgagggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccga |
178 |
Q |
|
|
||||||||||||| || |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23391521 |
gaaaagaaacttagataaatgggtgtgtgaaatgagggaaccaaataagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccga |
23391422 |
T |
 |
Q |
179 |
gcacatgatgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcagactccgcgtggcggct |
252 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23391421 |
gcacatgatgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcagactccgcgtggcggct |
23391348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 86 - 252
Target Start/End: Complemental strand, 23587201 - 23587035
Alignment:
Q |
86 |
aacttaaatgaatgggtgtgtgaaatgagggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatg |
185 |
Q |
|
|
|||||| || ||||||| |||||||||||||| || |||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || || | |
|
|
T |
23587201 |
aacttagataaatgggtttgtgaaatgagggagcctaacaagaagactaagatttggctagggacttttccaactgccgagatggcagcccgtgcccacg |
23587102 |
T |
 |
Q |
186 |
atgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcagactccgcgtggcggct |
252 |
Q |
|
|
||||||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
T |
23587101 |
atgttgctgcaatggcattgaggggccgctacgcttgtctcaactttgcagactcagcgtggcggct |
23587035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 86 - 252
Target Start/End: Complemental strand, 23583317 - 23583152
Alignment:
Q |
86 |
aacttaaatgaatgggtgtgtgaaatgagggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatg |
185 |
Q |
|
|
|||||| || ||||||| |||||||||||| | || |||||||||||||| ||||||||||| |||||||||||||||||||||||| |||| || || | |
|
|
T |
23583317 |
aacttagataaatgggtttgtgaaatgaggaagcctaacaagaagactaagatttggctagggacttttccaactgcggagatggcaacccgtgcccacg |
23583218 |
T |
 |
Q |
186 |
atgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcagactccgcgtggcggct |
252 |
Q |
|
|
||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| || |||||||| |
|
|
T |
23583217 |
atgttgctgcaatggcattga-gggccgctacgcctgtctcaactttgcagactcagcatggcggct |
23583152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 86 - 247
Target Start/End: Complemental strand, 23290045 - 23289884
Alignment:
Q |
86 |
aacttaaatgaatgggtgtgtgaaatgagggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatg |
185 |
Q |
|
|
|||||| || |||||||||||||||||||||||||||| |||||||||| ||||||||||| |||||| |||| || |||||||| ||||| ||||| | |
|
|
T |
23290045 |
aacttagataaatgggtgtgtgaaatgagggaaccaaataagaagactaggatttggctagggacttttgcaacagccgagatggctgcccgtgcacacg |
23289946 |
T |
 |
Q |
186 |
atgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcagactccgcgtgg |
247 |
Q |
|
|
| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
23289945 |
acgttgcagcaattgcattgaggggccgctacgcctgtctcaactttgcagactcggcgtgg |
23289884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 86 - 253
Target Start/End: Complemental strand, 23266614 - 23266447
Alignment:
Q |
86 |
aacttaaatgaatgggtgtgtgaaatgagggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatg |
185 |
Q |
|
|
|||||| || ||||||| ||||||||||||||||| |||| |||||||| |||||||||||| ||||||||||| || ||||||||||||||||| || | |
|
|
T |
23266614 |
aacttagataaatgggtttgtgaaatgagggaacccaacacgaagactagaatttggctaggaacttttccaacagccgagatggcagcccgagcccacg |
23266515 |
T |
 |
Q |
186 |
atgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcagactccgcgtggcggctt |
253 |
Q |
|
|
||||||| || |||||||||||||| ||||||||||||||||| |||||||| || | |||||||||| |
|
|
T |
23266514 |
atgttgctgcgatggcattgaggggtcgctacgcctgtctcaattttgcagattcggtgtggcggctt |
23266447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 86 - 249
Target Start/End: Complemental strand, 23252083 - 23251920
Alignment:
Q |
86 |
aacttaaatgaatgggtgtgtgaaatgagggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatg |
185 |
Q |
|
|
||||||||| ||||||| |||||||||||||| || |||| |||| || ||||||||||| ||||||||||| || ||||||||||||||||| || | |
|
|
T |
23252083 |
aacttaaataaatgggtttgtgaaatgagggagccgaacacaaagaataggatttggctaggaacttttccaacagccgagatggcagcccgagcccacg |
23251984 |
T |
 |
Q |
186 |
atgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcagactccgcgtggcg |
249 |
Q |
|
|
|||||||||| || ||||||||||||||||| ||||||||||| ||||||||||| | |||||| |
|
|
T |
23251983 |
atgttgccgcgatagcattgaggggccgctatgcctgtctcaattttgcagactcggtgtggcg |
23251920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 86 - 249
Target Start/End: Complemental strand, 23258059 - 23257896
Alignment:
Q |
86 |
aacttaaatgaatgggtgtgtgaaatgagggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatg |
185 |
Q |
|
|
|||||| || ||||||||||||||||||||||||| |||| ||||| | |||||||| || ||||||||||| | || |||||||||||||| || | |
|
|
T |
23258059 |
aacttagataaatgggtgtgtgaaatgagggaacccaacacaaagaccaggatttggctggggacttttccaacacccgaaatggcagcccgagcccacg |
23257960 |
T |
 |
Q |
186 |
atgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcagactccgcgtggcg |
249 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| | |||||| |
|
|
T |
23257959 |
atgttgccgcaatggcattgaggggccgctatgcctgtctcaattttgcagactcggtgtggcg |
23257896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 86 - 253
Target Start/End: Complemental strand, 23283732 - 23283565
Alignment:
Q |
86 |
aacttaaatgaatgggtgtgtgaaatgagggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatg |
185 |
Q |
|
|
|||||| || ||||||| ||||||||||||||||| ||||| ||||||| ||||||||||| ||||||||||| || |||||||| || |||||||| | |
|
|
T |
23283732 |
aacttagataaatgggtttgtgaaatgagggaacccaacaaaaagactaggatttggctagggacttttccaacggctgagatggctgcacgagcacacg |
23283633 |
T |
 |
Q |
186 |
atgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcagactccgcgtggcggctt |
253 |
Q |
|
|
| ||||| || |||||||| ||||||||||| ||||||||||||||||||||||| | |||| ||||| |
|
|
T |
23283632 |
acgttgcagccatggcattaaggggccgctatgcctgtctcaactttgcagactcggtgtggaggctt |
23283565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 86 - 253
Target Start/End: Complemental strand, 23634235 - 23634068
Alignment:
Q |
86 |
aacttaaatgaatgggtgtgtgaaatgagggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatg |
185 |
Q |
|
|
|||||| || |||||||||||||||||||||| || |||||||||||||| ||||||||||| ||||||||||| || ||||||||||| |||||||||| |
|
|
T |
23634235 |
aacttagataaatgggtgtgtgaaatgagggagcctaacaagaagactaagatttggctagggacttttccaacggccgagatggcagcacgagcacatg |
23634136 |
T |
 |
Q |
186 |
atgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcagactccgcgtggcggctt |
253 |
Q |
|
|
|||| || ||| ||||||| || || ||| |||||||||| || ||||| ||||| || | ||||||| |
|
|
T |
23634135 |
atgtcgcggcattggcattaagaggtcgcaacgcctgtcttaattttgctgactctgcctcgcggctt |
23634068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 86 - 249
Target Start/End: Complemental strand, 23247671 - 23247508
Alignment:
Q |
86 |
aacttaaatgaatgggtgtgtgaaatgagggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatg |
185 |
Q |
|
|
||||||||| ||||||| |||||||||||||| || |||| |||| || |||||||| || ||||||||||| |||||||||| |||||||| || | |
|
|
T |
23247671 |
aacttaaataaatgggtttgtgaaatgagggagccgaacacaaagaataggatttggctgggaacttttccaacaccggagatggctgcccgagcccacg |
23247572 |
T |
 |
Q |
186 |
atgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcagactccgcgtggcg |
249 |
Q |
|
|
||||||| ||||||||||||||||||||||| ||||||||||| || ||||||| | |||||| |
|
|
T |
23247571 |
atgttgctgcaatggcattgaggggccgctatgcctgtctcaatttctcagactcggtgtggcg |
23247508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 96 - 252
Target Start/End: Complemental strand, 23594257 - 23594101
Alignment:
Q |
96 |
aatgggtgtgtgaaatgagggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgc |
195 |
Q |
|
|
|||||||||||||||||||||| || ||||||| |||||| || |||||||| |||||||||| || ||||||| ||| ||||| |||||||| || | |
|
|
T |
23594257 |
aatgggtgtgtgaaatgagggagcctaacaagatgactaagatatggctaggaacttttccaatggctgagatggaagcacgagcccatgatgtcgcgac |
23594158 |
T |
 |
Q |
196 |
aatggcattgaggggccgctacgcctgtctcaactttgcagactccgcgtggcggct |
252 |
Q |
|
|
| |||||||||| || | ||||| |||||||||||||||||||| || |||||||| |
|
|
T |
23594157 |
attggcattgagaggttgttacgcttgtctcaactttgcagactctgcatggcggct |
23594101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 96 - 240
Target Start/End: Complemental strand, 23507045 - 23506901
Alignment:
Q |
96 |
aatgggtgtgtgaaatgagggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgc |
195 |
Q |
|
|
|||||||||||||||| || | || ||||| ||||| || ||||||||||| ||||||||||| || ||||||||||| || || ||||||||||| || |
|
|
T |
23507045 |
aatgggtgtgtgaaataagacagcctaacaaaaagaccaagatttggctaggaacttttccaacagccgagatggcagctcgggcccatgatgttgcggc |
23506946 |
T |
 |
Q |
196 |
aatggcattgaggggccgctacgcctgtctcaactttgcagactc |
240 |
Q |
|
|
| |||| |||| || || ||||||||||||||||||||||||| |
|
|
T |
23506945 |
actggcgttgaaaggtggcgacgcctgtctcaactttgcagactc |
23506901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 253
Target Start/End: Complemental strand, 23506796 - 23506726
Alignment:
Q |
183 |
atgatgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcagactccgcgtggcggctt |
253 |
Q |
|
|
||||||| || ||| ||||||| || || ||| ||||||||||||||||||||||||| || | ||||||| |
|
|
T |
23506796 |
atgatgtcgcggcattggcattaagaggtcgcaacgcctgtctcaactttgcagactcggcctcgcggctt |
23506726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 136 - 192
Target Start/End: Complemental strand, 3996441 - 3996385
Alignment:
Q |
136 |
aatttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgc |
192 |
Q |
|
|
||||||||||||||||| |||||| | ||||||||||| ||||| ||||| ||||| |
|
|
T |
3996441 |
aatttggctaggcacttatccaacacccgagatggcagctcgagcccatgacgttgc |
3996385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University