View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0954_low_26 (Length: 317)

Name: NF0954_low_26
Description: NF0954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0954_low_26
NF0954_low_26
[»] chr6 (13 HSPs)
chr6 (77-224)||(23391348-23391495)
chr6 (77-224)||(23587035-23587182)
chr6 (94-224)||(23583152-23583281)
chr6 (77-225)||(23266447-23266595)
chr6 (77-219)||(23289884-23290026)
chr6 (109-221)||(23251920-23252032)
chr6 (77-225)||(23283565-23283713)
chr6 (109-221)||(23257896-23258008)
chr6 (77-225)||(23634068-23634216)
chr6 (109-221)||(23247508-23247620)
chr6 (94-212)||(23506901-23507019)
chr6 (77-224)||(23594101-23594248)
chr6 (155-225)||(23506726-23506796)
[»] chr5 (1 HSPs)
chr5 (108-164)||(3996385-3996441)


Alignment Details
Target: chr6 (Bit Score: 136; Significance: 6e-71; HSPs: 13)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 77 - 224
Target Start/End: Complemental strand, 23391495 - 23391348
Alignment:
Q  77 gtgagatgaaggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgcaatggcatt 176  Q
    |||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23391495 gtgaaatgagggaaccaaataagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgcaatggcatt 23391396  T
Q  177 gaggggccgctacgcctgtctcaactttgcagactccgcgtggcggct 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  23391395 gaggggccgctacgcctgtctcaactttgcagactccgcgtggcggct 23391348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 77 - 224
Target Start/End: Complemental strand, 23587182 - 23587035
Alignment:
Q  77 gtgagatgaaggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgcaatggcatt 176  Q
    |||| |||| ||| || |||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || || |||||||| |||||||||||    
T  23587182 gtgaaatgagggagcctaacaagaagactaagatttggctagggacttttccaactgccgagatggcagcccgtgcccacgatgttgctgcaatggcatt 23587083  T
Q  177 gaggggccgctacgcctgtctcaactttgcagactccgcgtggcggct 224  Q
    ||||||||||||||| |||||||||||||||||||| |||||||||||    
T  23587082 gaggggccgctacgcttgtctcaactttgcagactcagcgtggcggct 23587035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 94 - 224
Target Start/End: Complemental strand, 23583281 - 23583152
Alignment:
Q  94 aacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgcaatggcattgaggggccgctacgcct 193  Q
    |||||||||||||| ||||||||||| |||||||||||||||||||||||| |||| || || |||||||| ||||||||||||| ||||||||||||||    
T  23583281 aacaagaagactaagatttggctagggacttttccaactgcggagatggcaacccgtgcccacgatgttgctgcaatggcattga-gggccgctacgcct 23583183  T
Q  194 gtctcaactttgcagactccgcgtggcggct 224  Q
    ||||||||||||||||||| || ||||||||    
T  23583182 gtctcaactttgcagactcagcatggcggct 23583152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 77 - 225
Target Start/End: Complemental strand, 23266595 - 23266447
Alignment:
Q  77 gtgagatgaaggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgcaatggcatt 176  Q
    |||| |||| |||||| |||| |||||||| |||||||||||| ||||||||||| || ||||||||||||||||| || |||||||| || ||||||||    
T  23266595 gtgaaatgagggaacccaacacgaagactagaatttggctaggaacttttccaacagccgagatggcagcccgagcccacgatgttgctgcgatggcatt 23266496  T
Q  177 gaggggccgctacgcctgtctcaactttgcagactccgcgtggcggctt 225  Q
    |||||| ||||||||||||||||| |||||||| || | ||||||||||    
T  23266495 gaggggtcgctacgcctgtctcaattttgcagattcggtgtggcggctt 23266447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 77 - 219
Target Start/End: Complemental strand, 23290026 - 23289884
Alignment:
Q  77 gtgagatgaaggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgcaatggcatt 176  Q
    |||| |||| ||||||||| ||||||||||  ||||||||||| |||||| |||| || |||||||| ||||| ||||| || ||||| ||||| |||||    
T  23290026 gtgaaatgagggaaccaaataagaagactaggatttggctagggacttttgcaacagccgagatggctgcccgtgcacacgacgttgcagcaattgcatt 23289927  T
Q  177 gaggggccgctacgcctgtctcaactttgcagactccgcgtgg 219  Q
    |||||||||||||||||||||||||||||||||||| ||||||    
T  23289926 gaggggccgctacgcctgtctcaactttgcagactcggcgtgg 23289884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 109 - 221
Target Start/End: Complemental strand, 23252032 - 23251920
Alignment:
Q  109 atttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcag 208  Q
    ||||||||||| ||||||||||| || ||||||||||||||||| || ||||||||||| || ||||||||||||||||| ||||||||||| |||||||    
T  23252032 atttggctaggaacttttccaacagccgagatggcagcccgagcccacgatgttgccgcgatagcattgaggggccgctatgcctgtctcaattttgcag 23251933  T
Q  209 actccgcgtggcg 221  Q
    |||| | ||||||    
T  23251932 actcggtgtggcg 23251920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 77 - 225
Target Start/End: Complemental strand, 23283713 - 23283565
Alignment:
Q  77 gtgagatgaaggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgcaatggcatt 176  Q
    |||| |||| |||||| ||||| |||||||  ||||||||||| ||||||||||| || |||||||| || |||||||| || ||||| || ||||||||    
T  23283713 gtgaaatgagggaacccaacaaaaagactaggatttggctagggacttttccaacggctgagatggctgcacgagcacacgacgttgcagccatggcatt 23283614  T
Q  177 gaggggccgctacgcctgtctcaactttgcagactccgcgtggcggctt 225  Q
     ||||||||||| ||||||||||||||||||||||| | |||| |||||    
T  23283613 aaggggccgctatgcctgtctcaactttgcagactcggtgtggaggctt 23283565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 109 - 221
Target Start/End: Complemental strand, 23258008 - 23257896
Alignment:
Q  109 atttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcag 208  Q
    |||||||| || |||||||||||  | || |||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||| |||||||    
T  23258008 atttggctggggacttttccaacacccgaaatggcagcccgagcccacgatgttgccgcaatggcattgaggggccgctatgcctgtctcaattttgcag 23257909  T
Q  209 actccgcgtggcg 221  Q
    |||| | ||||||    
T  23257908 actcggtgtggcg 23257896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 77 - 225
Target Start/End: Complemental strand, 23634216 - 23634068
Alignment:
Q  77 gtgagatgaaggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgcaatggcatt 176  Q
    |||| |||| ||| || |||||||||||||| ||||||||||| ||||||||||| || ||||||||||| |||||||||||||| || ||| |||||||    
T  23634216 gtgaaatgagggagcctaacaagaagactaagatttggctagggacttttccaacggccgagatggcagcacgagcacatgatgtcgcggcattggcatt 23634117  T
Q  177 gaggggccgctacgcctgtctcaactttgcagactccgcgtggcggctt 225  Q
     || || ||| |||||||||| || ||||| ||||| || | |||||||    
T  23634116 aagaggtcgcaacgcctgtcttaattttgctgactctgcctcgcggctt 23634068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 109 - 221
Target Start/End: Complemental strand, 23247620 - 23247508
Alignment:
Q  109 atttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcag 208  Q
    |||||||| || |||||||||||  |||||||||| |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||| ||  |||    
T  23247620 atttggctgggaacttttccaacaccggagatggctgcccgagcccacgatgttgctgcaatggcattgaggggccgctatgcctgtctcaatttctcag 23247521  T
Q  209 actccgcgtggcg 221  Q
    |||| | ||||||    
T  23247520 actcggtgtggcg 23247508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 94 - 212
Target Start/End: Complemental strand, 23507019 - 23506901
Alignment:
Q  94 aacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgcaatggcattgaggggccgctacgcct 193  Q
    ||||| ||||| || ||||||||||| ||||||||||| || ||||||||||| || || ||||||||||| ||| |||| ||||  ||  || ||||||    
T  23507019 aacaaaaagaccaagatttggctaggaacttttccaacagccgagatggcagctcgggcccatgatgttgcggcactggcgttgaaaggtggcgacgcct 23506920  T
Q  194 gtctcaactttgcagactc 212  Q
    |||||||||||||||||||    
T  23506919 gtctcaactttgcagactc 23506901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 77 - 224
Target Start/End: Complemental strand, 23594248 - 23594101
Alignment:
Q  77 gtgagatgaaggaaccaaacaagaagactaaaatttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgccgcaatggcatt 176  Q
    |||| |||| ||| || ||||||| |||||| || |||||||| ||||||||||  || ||||||| ||| ||||| |||||||| ||  || |||||||    
T  23594248 gtgaaatgagggagcctaacaagatgactaagatatggctaggaacttttccaatggctgagatggaagcacgagcccatgatgtcgcgacattggcatt 23594149  T
Q  177 gaggggccgctacgcctgtctcaactttgcagactccgcgtggcggct 224  Q
    ||| ||  | ||||| |||||||||||||||||||| || ||||||||    
T  23594148 gagaggttgttacgcttgtctcaactttgcagactctgcatggcggct 23594101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 155 - 225
Target Start/End: Complemental strand, 23506796 - 23506726
Alignment:
Q  155 atgatgttgccgcaatggcattgaggggccgctacgcctgtctcaactttgcagactccgcgtggcggctt 225  Q
    ||||||| || ||| ||||||| || || ||| ||||||||||||||||||||||||| || | |||||||    
T  23506796 atgatgtcgcggcattggcattaagaggtcgcaacgcctgtctcaactttgcagactcggcctcgcggctt 23506726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 164
Target Start/End: Complemental strand, 3996441 - 3996385
Alignment:
Q  108 aatttggctaggcacttttccaactgcggagatggcagcccgagcacatgatgttgc 164  Q
    ||||||||||||||||| ||||||  | ||||||||||| ||||| ||||| |||||    
T  3996441 aatttggctaggcacttatccaacacccgagatggcagctcgagcccatgacgttgc 3996385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University