View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0954_low_32 (Length: 261)
Name: NF0954_low_32
Description: NF0954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0954_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 30 - 252
Target Start/End: Original strand, 4292415 - 4292633
Alignment:
| Q |
30 |
gaatcaacttgagtagtgggatcgaaaataattagagatgtttgcgaatcggtttggtttgattttaaataaacttgatgtcctggtcgatcaaacaaac |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4292415 |
gaatcaacttgagtagtgggatcgaaaataattagggatgtttgcgaatcggtttggtttgattttaaataaacttgatgtcctggtcgatcaaa----c |
4292510 |
T |
|
| Q |
130 |
atatacagattgagttgagttggatttgtatattttgagataaaattcaaaacgaacagataaacaacaaattgaattggaccggattgattgggtaatc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4292511 |
atatacagattgagttgagttggatttgtatattttgagataaaattcaaaacgaacagataaacaacaaattgaattggaccggattgattgggtaatc |
4292610 |
T |
|
| Q |
230 |
ctactctatactctgtgtgatct |
252 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4292611 |
ctactctatactctgtgtgatct |
4292633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University