View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0954_low_33 (Length: 252)
Name: NF0954_low_33
Description: NF0954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0954_low_33 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 7 - 252
Target Start/End: Complemental strand, 44531813 - 44531568
Alignment:
| Q |
7 |
tccaataatatcctcaaccttttctaaactctcatgtagtagcaacctatgcaatgctttaccttctccaacttgcagcaacaatggttgcaattatgtt |
106 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44531813 |
tccaaaaaaatcctcaaccttttctaaactctcatgtagtagcaacctatgcaatgctttaccttctccaacttgcagcaacaatggttgcaattatgtt |
44531714 |
T |
|
| Q |
107 |
tattcatatggtgattattctatgacacaaggtattttaggtagtgaaacattcacttttggtgatgatnnnnnnnnccaagtttcagttaaaaacattg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44531713 |
tattcatatggtgattattctatgacacaaggtattttaggtagtgaaacattcacttttggtgatgataaaaaaaaccaagtttcagttaaaaacattg |
44531614 |
T |
|
| Q |
207 |
gttttggttgtggtgaagacaatgaaggaaaagggtttgaacaagc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44531613 |
gttttggttgtggtgaagacaatgaaggaaaagggtttgaacaagc |
44531568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University