View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0955_low_12 (Length: 270)
Name: NF0955_low_12
Description: NF0955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0955_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 49 - 241
Target Start/End: Original strand, 3131709 - 3131901
Alignment:
| Q |
49 |
gtagagagtgccagtggcaataccgaggagcacgatgaggaggaaggttaatgccataaaccaacaaaagcaacggcatcgccggttagggcgttgtctt |
148 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3131709 |
gtagagagtgccagtagcaataccgaggagcacgatgaggaggaaggttaatgccataaaccaacaaaagcaacggcatcgccggttagggcgttgtctt |
3131808 |
T |
|
| Q |
149 |
aggcgagtgtattcttggtagcggcgagctttctccgatggagagacactgaaggtttgattcttgggagctttgatgactagggctctctgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3131809 |
aggcgagtgtattcttggtagcggcgagctttctccgatggagagacactgaaggtttgattcttgggagctttgatgactagggctctctgc |
3131901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University