View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0955_low_17 (Length: 245)

Name: NF0955_low_17
Description: NF0955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0955_low_17
NF0955_low_17
[»] chr5 (1 HSPs)
chr5 (1-136)||(7430894-7431022)


Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 7430894 - 7431022
Alignment:
1 caccttcacagtaatcaaaacaaaatcaagttctatataacccatatagcaccaaccaccaagacttcacatacagttacattcaatattacatgtttta 100  Q
    |||||||||| || |||||||||||||||||||||||||||||||||||||||       |||||||||||| |||||||||||||||||||||||||||    
7430894 caccttcacactattcaaaacaaaatcaagttctatataacccatatagcacc-------aagacttcacatccagttacattcaatattacatgtttta 7430986  T
101 atactattaccggtgtcaacatgtccggtgtctgtg 136  Q
    ||||||||||||||||||||||||||||||||||||    
7430987 atactattaccggtgtcaacatgtccggtgtctgtg 7431022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University