View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0955_low_20 (Length: 217)
Name: NF0955_low_20
Description: NF0955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0955_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 39120111 - 39120249
Alignment:
| Q |
1 |
tggcactacaatactgcaagtcactctgccacaggtttgtctgcgtttcaggttgtctatagttgcaaacccccct------ccctgtcccactatgttt |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
39120111 |
tggcactacgatactgcaagtcactctgccacaagtttgtctgcgtttcaggttgtatatagtcgcaaacccccctccctgaccctgtcccactatgttt |
39120210 |
T |
 |
| Q |
95 |
ccaactccataatcagaaggtcctgaaccaagaattatc |
133 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39120211 |
ccaactccataatcagcaggtcctgaaccaagaattatc |
39120249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 5 - 124
Target Start/End: Complemental strand, 38611453 - 38611334
Alignment:
| Q |
5 |
actacaatactgcaagtcactctgccacaggtttgtctgcgtttcaggttgtctatagttgcaaacccccctccctgtcccactatgtttccaactccat |
104 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| || |||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
38611453 |
actacaatacagcaagtcactctgccacaggtttgtctgtgtttcaggttgtctatagtcgcgaaccaccttccctgtcccattatgtttccaactccat |
38611354 |
T |
 |
| Q |
105 |
aatcagaaggtcctgaacca |
124 |
Q |
| |
|
|||||| |||||||| |||| |
|
|
| T |
38611353 |
aatcagcaggtcctggacca |
38611334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 39117903 - 39118035
Alignment:
| Q |
1 |
tggcactacaatactgcaagtcactctgccacaggtttgtctgcgtttcaggttgtctatagttgcaaacccccctccctgtcccactatgtttccaact |
100 |
Q |
| |
|
||||||| |||||| | |||||||||||||||||| ||||||| |||||||||||| |||||| || |||| |||||||||||||| | ||||||||||| |
|
|
| T |
39117903 |
tggcacttcaatacaggaagtcactctgccacagggttgtctgtgtttcaggttgtttatagtcgcgaaccaccctccctgtcccattctgtttccaact |
39118002 |
T |
 |
| Q |
101 |
ccataatcagaaggtcctgaaccaagaattatc |
133 |
Q |
| |
|
|||||||| | |||||||| |||||||| |||| |
|
|
| T |
39118003 |
ccataatctgcaggtcctgtaccaagaactatc |
39118035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University