View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0955_low_7 (Length: 366)
Name: NF0955_low_7
Description: NF0955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0955_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 59 - 300
Target Start/End: Complemental strand, 26933487 - 26933240
Alignment:
Q |
59 |
gagaaaactaatcaattttatgagtattt-----catggtgagtttgaagaatcacaaatcacagtgtgcaa-ccatgattttagttacactcatgaatt |
152 |
Q |
|
|
|||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||| ||| |||||| ||||||||||||| |||||| |
|
|
T |
26933487 |
gagaaaactaatcaattttacgagtatttggattcatggtgagtttgcagaatcacaaatcacaaatcacaaaccatgactttagttacactcttgaatt |
26933388 |
T |
 |
Q |
153 |
tcaacaaaattacaatgtcgccgtgatttcattaagttcaccgtaaataaaaacatacacttcatttttgaaatattagccaaactttacttaccttctc |
252 |
Q |
|
|
||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
T |
26933387 |
tcaacaaaattacaatgtcactgtgatttcattaagttcaccgtaaatagaaacatacacttcattcttgaaatattagcaaaactttacttaccttctc |
26933288 |
T |
 |
Q |
253 |
attgaaatttggactcccataacctctttttattgagaggattatgac |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26933287 |
attgaaatttggactcccataacctctttttattgagaggattatgac |
26933240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University