View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0955_low_8 (Length: 337)
Name: NF0955_low_8
Description: NF0955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0955_low_8 |
 |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0154 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 80 - 222
Target Start/End: Complemental strand, 22610 - 22468
Alignment:
| Q |
80 |
gagtgagatgaaagtattctagagtttattcacttgggaaaggcataggtataagattactataacaagatttaaattaagaggggaaaccgcgtttggt |
179 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22610 |
gagtgagatcaaagtattctagagtttattcacttgggaaaggcataggtataagattactataacaagatttaaattaagaggggaaaccgcgtttggt |
22511 |
T |
 |
| Q |
180 |
atgaattatacaaagcatgagaaaagaaaagatggtgtaggtg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22510 |
atgaattatacaaagcatgagaaaagaaaagatggtgtaggtg |
22468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University