View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0956_high_9 (Length: 279)
Name: NF0956_high_9
Description: NF0956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0956_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 20 - 253
Target Start/End: Complemental strand, 31856644 - 31856411
Alignment:
| Q |
20 |
gacatctaagtatttttcaaatgaaagtgatatcaacatttcttttaatcacttcagtaaaattggtttttggacagattagtacaccttgcacaacttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31856644 |
gacatctaagtatttttcaaatgaaagtgatatcaacatttcttttaatcacttcagtaaaattggtttttggacagattagtacaccttgcacaacttc |
31856545 |
T |
 |
| Q |
120 |
tatgattagtagtttcaccccatgtgcaaatttcattacaggaagcaccaattataatggtttaataacaccatcaagtagttgttgtgattcattacag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31856544 |
tatgattagtagtttcaccccatgtgcaaatttcattacaggaagcaccaattataatggtttaataacaccatcaagtagttgttgtgattcattacag |
31856445 |
T |
 |
| Q |
220 |
tctatgatgagtactagtatggattgtgcttgct |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31856444 |
tctatgatgagtactagtatggattgtgcttgct |
31856411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 37 - 116
Target Start/End: Complemental strand, 31865670 - 31865591
Alignment:
| Q |
37 |
caaatgaaagtgatatcaacatttcttttaatcacttcagtaaaattggtttttggacagattagtacaccttgcacaac |
116 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
31865670 |
caaatgaaagtgatatcaatatttcatttaatcacttcattaaaattggtttttgtacagattagtacacgttgcacaac |
31865591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 189 - 252
Target Start/End: Original strand, 38117877 - 38117940
Alignment:
| Q |
189 |
accatcaagtagttgttgtgattcattacagtctatgatgagtactagtatggattgtgcttgc |
252 |
Q |
| |
|
|||||||| || |||||||||||||||| |||| ||||||| || | |||||||||||||||| |
|
|
| T |
38117877 |
accatcaactacttgttgtgattcattaaggtctttgatgagcacaaatatggattgtgcttgc |
38117940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University