View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0956_low_15 (Length: 328)
Name: NF0956_low_15
Description: NF0956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0956_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 114 - 299
Target Start/End: Complemental strand, 55078890 - 55078705
Alignment:
| Q |
114 |
tctgatcatcaatgatggccaccagaggtggcaatcgaaggcttggcagtatcaacagactttggagtaggaagaataattaccgccaatatagcgctga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55078890 |
tctgatcatcaatgatggccaccagaggtggcaatcgatggcttggcagtatcaacagactttggagtaggaagaataattaccgccaatacagcgctga |
55078791 |
T |
 |
| Q |
214 |
tgactgcggccacaacaccgaccacaaacgccggcaagttgccaccaccaaacaaagcatcccacggtccacttaatgacgatact |
299 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55078790 |
tgactgcggccacagcatcgaccacaaacgccggcaagttgccaccaccaaacaaagcatcccacggtccacttaatgacgatact |
55078705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 173 - 291
Target Start/End: Original strand, 15123015 - 15123133
Alignment:
| Q |
173 |
ctttggagtaggaagaataattaccgccaatatagcgctgatgactgcggccacaacaccgaccacaaacgccggcaagttgccaccaccaaacaaagca |
272 |
Q |
| |
|
|||||||||||| |||| || | |||||| |||| ||||||||||| ||||| |||| ||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
15123015 |
ctttggagtaggcagaaggataattgccaatgtagcactgatgactgccgccaccgcaccaaccacgaacgcaggtaagttgccaccaccaaacaaagag |
15123114 |
T |
 |
| Q |
273 |
tcccacggtccacttaatg |
291 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
15123115 |
tcccattgtccacttaatg |
15123133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University