View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0956_low_18 (Length: 314)
Name: NF0956_low_18
Description: NF0956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0956_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 30 - 239
Target Start/End: Original strand, 9996019 - 9996223
Alignment:
| Q |
30 |
aaaaagcgatgttgaaatgaagagaactatgtatgatttccaaaagcgagggagtgagaaatgtgacaatactatgtggtcactgtctaggtactaggta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9996019 |
aaaaagcgatgttgaaatgaagagaactatgtatgatttccaaaagcgagggagtgagaaatgtgacaatactatgtggtcactgtctaggtactaggta |
9996118 |
T |
|
| Q |
130 |
gtttaatgaggaatcttggctttctaatgcccttacaacagagatgtcatatgcgggtgatcactgcgtttgaggttatttggagcccgggctttcgtaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9996119 |
gtttaatgaggaatcttggctttctaatgcccttacaacagagatg-----tgcgggcgatcactgcgtttgaggttatttggagctcgggctttcgtaa |
9996213 |
T |
|
| Q |
230 |
aaatatgacc |
239 |
Q |
| |
|
|||||||||| |
|
|
| T |
9996214 |
aaatatgacc |
9996223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 241 - 305
Target Start/End: Original strand, 9996688 - 9996752
Alignment:
| Q |
241 |
gatggtgttggtgaagcttatggttcatggttgtgtgccttctcacattgactattgatctgtgc |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9996688 |
gatggtgttggtgaagcttatggttcatggttgtgtgccttctcacattgactattgatctgtgc |
9996752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University