View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0956_low_24 (Length: 251)
Name: NF0956_low_24
Description: NF0956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0956_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 13135184 - 13134998
Alignment:
Q |
1 |
ccaatattctcaatttctcgttctgtcaccacaaaaattaccaattaattaggttatatcaaagtcttaaatatcaagcatagtcgcgttaaaaatttcg |
100 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
13135184 |
ccaatattctcaatttctcgctctgtcaccacaaaaattaccaattaattagattatatcaaagtcttaaatatcaagcatagtcgcgttaaaaattttg |
13135085 |
T |
 |
Q |
101 |
cgattttggttgttgcgaatgttgtgatgcataacctatgtatcatgtatgttgtagtgtcaatgaatcatataattgtgcaaatcg |
187 |
Q |
|
|
|||||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
13135084 |
cgattttgattgttgcgaatgttgtgatgcgtaacctatgtatcatgtgtgttgtagtgtcaatgaatcatataattgtgcaaatcg |
13134998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University