View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0956_low_31 (Length: 204)
Name: NF0956_low_31
Description: NF0956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0956_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 51 - 185
Target Start/End: Original strand, 6828999 - 6829133
Alignment:
Q |
51 |
ctgcacttgctaagttggatggtgttttggtaaatgttcagtctctcaaaggggatttcaaatttatcaaccttgatacgcaaatacaagctgtggagga |
150 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6828999 |
ctgcacttgctaagttggatggtgttttggtaaatgttcagtctctcaaaggggatttcaaatttatcaaccttgatacgcaaatacaagctgtggagga |
6829098 |
T |
 |
Q |
151 |
tagaatgaaatgtctccgaggctttatgcgaattt |
185 |
Q |
|
|
||||||||| ||||||||||||||||| ||||||| |
|
|
T |
6829099 |
tagaatgaagtgtctccgaggctttattcgaattt |
6829133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University