View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0957_high_18 (Length: 251)
Name: NF0957_high_18
Description: NF0957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0957_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 62 - 247
Target Start/End: Original strand, 25731067 - 25731254
Alignment:
| Q |
62 |
tttggtggattcctgttttggttatattggcctcagtttgctcttttgattatcacatgggcg--acaacaatccttaatttttatgatatgttatttct |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25731067 |
tttggtggattcctgttttggttatattggcctcagtttgctcttttgattatcacatgggcgcgacaacaatccttaatttttatgatatgttatttcc |
25731166 |
T |
 |
| Q |
160 |
ttttcggatgttgcgaatgtcacctctcatgaattagaacatcctgtgcgtgattcagcttctattctcctgcattattggaatactg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25731167 |
ttttcggatgttgcgaatgtcacctctcatgaattagaacatcctgtgcgtgattcagcttccattctcctgcattattggaatactg |
25731254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University