View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0957_low_17 (Length: 294)
Name: NF0957_low_17
Description: NF0957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0957_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 34 - 286
Target Start/End: Complemental strand, 42494013 - 42493766
Alignment:
| Q |
34 |
tgaaggactcaaatagtatactattgcattgcagtaacctaatttaacatgatatggtgaagaagtttcatagatattatacaacttcaacttcaaggaa |
133 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42494013 |
tgaaggactcaaatagtatactattgca-----gtaacctaatttaacatgatatggtgaagaagtttcatagatattatacaacttcaacttcaaggaa |
42493919 |
T |
 |
| Q |
134 |
gaatcacgaggagttgaagaaggtttcatacctagccagctgaccactttcttcaagcaactcagtagtatatttgcactgatcatcaagaatttaactc |
233 |
Q |
| |
|
| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
42493918 |
ggatcacgaggagttgaagaaggtttcatgcctagctagctgaccactttcttcaagcaactcaatagtatatttgcactgatcatcaataatttaactc |
42493819 |
T |
 |
| Q |
234 |
tctgattaagcaattttgaccccgacataatggagtgtgcctaaacctatgat |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42493818 |
tctgattaagcaattttgaccccgacataatggagtgtgcctaaacctatgat |
42493766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 149 - 286
Target Start/End: Complemental strand, 42496084 - 42495948
Alignment:
| Q |
149 |
gaagaaggtttcatacctagccagctgacc-actttcttcaagcaactcagtagtatat----ttgcactgatcatcaagaatttaactctctgattaag |
243 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||||||||||||||||||| |||||||| |||| ||| ||||||||||||||||| ||| |
|
|
| T |
42496084 |
gaagaaggtttcatgtctagctagctgacccactttcttcaagcaactcaatagtatatatatttgccgtgaatatcaagaatttaactct------aag |
42495991 |
T |
 |
| Q |
244 |
caattttgaccccgacataatggagtgtgcctaaacctatgat |
286 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
42495990 |
caatttagaccccgacataatttagtgtgcctaaacctatgat |
42495948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University