View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0957_low_18 (Length: 283)
Name: NF0957_low_18
Description: NF0957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0957_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 83 - 205
Target Start/End: Complemental strand, 29403872 - 29403750
Alignment:
| Q |
83 |
gaacctgtgtcaaattttatgtgcttgcgaaaagggggaaatgttcttataaactgagtttggctctaaaataaacaagtccatctaagactgatttgaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29403872 |
gaacctgtgtcaaattttatgtgcttgcaaaatgggggaaatgttcttataaactgagtttggctctaaaataaacaagtccatctaagactgatttgaa |
29403773 |
T |
|
| Q |
183 |
atgtattgtaatttcatctcact |
205 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29403772 |
atgtattgtaatttcatctcact |
29403750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University