View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0957_low_20 (Length: 279)
Name: NF0957_low_20
Description: NF0957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0957_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 44 - 224
Target Start/End: Original strand, 42494137 - 42494317
Alignment:
| Q |
44 |
ttttaaaccaagtgcattaccaactttttaccaaagtactttactacctcatgttctctagttaaaggcttgctactatcttttcttcacttaagctctt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42494137 |
ttttaaaccaagtgcattaccaactttttaccaaagtactttactacctcatgttctctagttaaaggcttgctactatcttttcttcacttaagctctt |
42494236 |
T |
 |
| Q |
144 |
aggttttgcatatttctgagatggccaacagtctcacttctagaaattctgtagcaagttattgttttattctttgttatt |
224 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42494237 |
aggttttgcatatttgtgagatggccaacagtctcacttctagaaattctgtagcaagttattgttttattctttgatatt |
42494317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Original strand, 42494137 - 42494166
Alignment:
| Q |
19 |
ttttaaaccaagtgcattaccaacttttta |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42494137 |
ttttaaaccaagtgcattaccaacttttta |
42494166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University