View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0957_low_21 (Length: 269)
Name: NF0957_low_21
Description: NF0957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0957_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 16910477 - 16910217
Alignment:
Q |
1 |
aaattgatttgtcacgatgagacagaactgaaaacacaaattgattataattcggtaagccacgagcgaatactgaattattcaatgcaagagtcgtgac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
16910477 |
aaattgatttgtcacgatgagacagaactgaaaacacaaattgattataattgggtaagccacgagcgaatactgaattattcaatgcaagagtagtgac |
16910378 |
T |
 |
Q |
101 |
tcttcgccaaagtgtcttccatctagtagacaatacacaagtttgaacaacttgttttgtgtccataaacttcatcatattgagcaaaacagaatcacac |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
16910377 |
tcttcgccaaagtgtcttccatctagtagacaatacacaagtttgaacaacttgttttgtgtccataaacttcattatattgagcaaaacagaatcacac |
16910278 |
T |
 |
Q |
201 |
aagtcactaagccggtctttttctatttctttttcatctcttttactcttcatcctttgct |
261 |
Q |
|
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
T |
16910277 |
aagtcactaagccggtctttttctctttcttttttatctcttttactcttcatcctttgct |
16910217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University