View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0957_low_22 (Length: 264)
Name: NF0957_low_22
Description: NF0957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0957_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 102 - 226
Target Start/End: Original strand, 40731190 - 40731317
Alignment:
| Q |
102 |
ttgtacttgaaaattgaaataaggatgctattgccaatttaaggtatt---tttaaacttatggaatggtagctttttgtctctttatggtgacatacta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40731190 |
ttgtacttgaaaattgaaataaggatgctattgccaatttaaggtattgtttttaaacttatggaatggtagctttttgtctctttatggtgacatacta |
40731289 |
T |
|
| Q |
199 |
gcatgttttagatggtgcatactattac |
226 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
40731290 |
gcatgttttagatggtgcatactattac |
40731317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University