View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0957_low_26 (Length: 252)
Name: NF0957_low_26
Description: NF0957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0957_low_26 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 30 - 252
Target Start/End: Complemental strand, 31617732 - 31617511
Alignment:
| Q |
30 |
attaaaacttaaaattcgtttgtattaaactttatatatatcctttaaagttcaaagaaagaaaataaaatgataaatccaagagtaaatcttttgaaag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31617732 |
attaaaacttaaaattcgtttgtattaaactttaaatatattctttaaagttcaaacaaagaaaataaa-tgataaatccaagagtaaatcttttgaaag |
31617634 |
T |
|
| Q |
130 |
taattaagtagtacatataattgtacttttgtaaattggtagcactacaacaagtcctagctagatggttgatatatttatttgtttatttatttctctc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31617633 |
taattaagtagtacatataattgtacttttgtaaattggtagcactacaacaagtcctagctagatggttgatatatttatttgtttatttatttctttc |
31617534 |
T |
|
| Q |
230 |
tttcaaaaactaacttgtccttc |
252 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
31617533 |
tttcaaaaactaacctgtccttc |
31617511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University