View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0957_low_27 (Length: 251)

Name: NF0957_low_27
Description: NF0957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0957_low_27
NF0957_low_27
[»] chr3 (1 HSPs)
chr3 (62-247)||(25731067-25731254)


Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 62 - 247
Target Start/End: Original strand, 25731067 - 25731254
Alignment:
62 tttggtggattcctgttttggttatattggcctcagtttgctcttttgattatcacatgggcg--acaacaatccttaatttttatgatatgttatttct 159  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||     
25731067 tttggtggattcctgttttggttatattggcctcagtttgctcttttgattatcacatgggcgcgacaacaatccttaatttttatgatatgttatttcc 25731166  T
160 ttttcggatgttgcgaatgtcacctctcatgaattagaacatcctgtgcgtgattcagcttctattctcctgcattattggaatactg 247  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
25731167 ttttcggatgttgcgaatgtcacctctcatgaattagaacatcctgtgcgtgattcagcttccattctcctgcattattggaatactg 25731254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University