View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0957_low_29 (Length: 251)
Name: NF0957_low_29
Description: NF0957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0957_low_29 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 45703021 - 45703261
Alignment:
| Q |
13 |
aatatccctatattcctcatctctatccaattgatggtcaaaatccgttgttgtttgtcttcctctagtat--ttgatggaggagtctcaccctcttctt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45703021 |
aatatccctatattcctcatctctatccaattgatggtcaaaatccgttgttgtttgtcttcctctagtatatttgatggaggagtctcaccctcttctt |
45703120 |
T |
 |
| Q |
111 |
tgtctcttgtctcactagtggaaggctccaactcaaactatgttttcttctactttgtttctgagtgaatattcaataggtccttgcacttcatccacat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45703121 |
tgtctcttgtctcactagtggaaggctccaactcaaactaagttttcttctactttgtttctgagtgaatattcagtaggtccttgcacttcatccacat |
45703220 |
T |
 |
| Q |
211 |
attggtctcatcaaaaataatatttatgcttataataaatc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45703221 |
attggtctcatcaaaaataatatttatgcttataataaatc |
45703261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 250
Target Start/End: Complemental strand, 15314821 - 15314758
Alignment:
| Q |
187 |
taggtccttgcacttcatccacatattggtctcatcaaaaataatatttatgcttataataaat |
250 |
Q |
| |
|
|||||| ||||||||||||| ||| | ||||||||||||||||| || |||||||||||||| |
|
|
| T |
15314821 |
taggtctttgcacttcatccccatgtgggtctcatcaaaaataacatccctgcttataataaat |
15314758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University