View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0957_low_32 (Length: 241)
Name: NF0957_low_32
Description: NF0957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0957_low_32 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 6026218 - 6026129
Alignment:
| Q |
1 |
acaaccataacatttatgctcacagcttggtggacttgaccctattttactcacttctctatcattttctacctccatattcttcgacat |
90 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||| |
|
|
| T |
6026218 |
acaatcatagcatttatgctcacagcttggtggacttgaccctattttactcacttctctatcattttctacctcccttttctttgacat |
6026129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 164 - 241
Target Start/End: Complemental strand, 760607 - 760530
Alignment:
| Q |
164 |
caatccgtttgaatcatgttaaagaaaaagctgatacacttgtagcatgacatcataattcaatttccaaatggattc |
241 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||||| |
|
|
| T |
760607 |
caatacgtttgaatcatgttaaagaaaaagctgatacacttgtggcatgacatcatcattcaatttacaaatggattc |
760530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 45
Target Start/End: Complemental strand, 42824206 - 42824166
Alignment:
| Q |
5 |
ccataacatttatgctcacagcttggtggacttgaccctat |
45 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
42824206 |
ccataacacttgtgctcacagcttggtggacttgaccctat |
42824166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University