View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0957_low_34 (Length: 230)
Name: NF0957_low_34
Description: NF0957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0957_low_34 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 11 - 230
Target Start/End: Complemental strand, 45703599 - 45703380
Alignment:
| Q |
11 |
tatttacccacttgatgaatgaaaattaacattttaaaatgtgtgagatgtatgcatatgagagataggtatccaaagagtttttggtctgaagttgtga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
45703599 |
tatttacccacttgatgaatgaaaattaacattttaaaatgtgtgagatgtatgcatatgagagataggtaaccaaagagtttcaggtctgaagttgtga |
45703500 |
T |
 |
| Q |
111 |
gtacatcaacgtaattgatcaatagaagtctgtcaacacaacttcaagagaactatgaatgtttggagtggaaaaccaacaaactgctataatttcaaag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45703499 |
gtacatcaacgtaattgatcaatagaagtctgtcaacacaacttcaagagaactatgaatgtttggagtggaaaaccaacaaactgctataatttcaaag |
45703400 |
T |
 |
| Q |
211 |
ttttcataactttggcgttc |
230 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45703399 |
ttttcataactttggcgttc |
45703380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University