View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0957_low_35 (Length: 229)
Name: NF0957_low_35
Description: NF0957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0957_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 97 - 220
Target Start/End: Complemental strand, 27134310 - 27134187
Alignment:
| Q |
97 |
tcaggtgtagttgtggctttgtcttttatatccttaagcccaccgcaacatcctgcagggggagggtcatcaccgggtgttgtagcatacccagcacatg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27134310 |
tcaggtgtagttgtggctttgtcttttatatccttaagcccaccgcaacatcctgcagggggagggtcatcgccgggtgttgtagcatacccagcacatg |
27134211 |
T |
|
| Q |
197 |
gatataaagtatctgtcacttcat |
220 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
27134210 |
gatataaagtatctgtcacttcat |
27134187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University