View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0959_high_14 (Length: 313)
Name: NF0959_high_14
Description: NF0959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0959_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 32540257 - 32540037
Alignment:
Q |
1 |
tgaatgtcctgatggaacagtattatttttgttctttttcattgcttttgtcctgaatctcctgccacttccccaaccaagcttggcttggcttggctct |
100 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
T |
32540257 |
tgaatctcctgatggaacagtattatttttgttctttttcattgcttttgtcctgaatctcctgccacttccccaaccaagcttggtttggct-----ct |
32540163 |
T |
 |
Q |
101 |
tgatcagtctcacacagaccttttgtggcataggctctcataattgccatcactacattttacttttggttttcctttaccaccacaacaacactaacac |
200 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32540162 |
tgatcagtctcacacagaccttttgtggcacaggctctcataattgccatcactacattttacttttggttttcctttaccaccacaacaacactaacac |
32540063 |
T |
 |
Q |
201 |
gtattgcaacttcaatgaaacattga |
226 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
32540062 |
gtattgcaacttcaatgaaacattga |
32540037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University