View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0959_high_19 (Length: 270)
Name: NF0959_high_19
Description: NF0959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0959_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 31 - 238
Target Start/End: Complemental strand, 30258001 - 30257794
Alignment:
| Q |
31 |
cagagagcagatgtggaagattgctgtcaatttgaggtggcccagagttcatgttaggatcctcttgcaaaattttagtaacttgaaaaatggaagtgta |
130 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30258001 |
cagagagcagatgtgaaagattgctgtcaatttgaggtggcccagagttcatgttaggatcctcttgcaaaattttagtaacttgaaaaatggaagtgta |
30257902 |
T |
|
| Q |
131 |
aaactttggattaagtttatccggagacttgcaccggtatcgtctatgtggcggagtattgttttcggtccattcaattttccatccaagataaacaaga |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30257901 |
aaactttggattaagtttatccggagacttgtaccggtatcgtctatgtggaggagtattgttttcggtccattcaattgtccatccaagataaacaaga |
30257802 |
T |
|
| Q |
231 |
tgttttct |
238 |
Q |
| |
|
|||||||| |
|
|
| T |
30257801 |
tgttttct |
30257794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University