View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0959_high_24 (Length: 214)
Name: NF0959_high_24
Description: NF0959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0959_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 30100138 - 30100014
Alignment:
| Q |
1 |
tgaggttcaacaatacgatcaaccaaaaatatatttaaaatcacctgacgatttcagatccttgagttttgacaatatcttcaagaacttgctcactcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30100138 |
tgaggttcaacaatacgatcaaccaaaaatacatttaaaatcacctgacaatttcagatccttgagttttgacgatatcttcaagaacttgctcactcaa |
30100039 |
T |
|
| Q |
101 |
gctaagacgcctaacttgatgatgt |
125 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
30100038 |
gctaagacgcctaacttgatcatgt |
30100014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University