View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0959_low_11 (Length: 343)
Name: NF0959_low_11
Description: NF0959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0959_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 75 - 214
Target Start/End: Original strand, 10552169 - 10552313
Alignment:
| Q |
75 |
tatgttatttttagagatataagttttcttttt----ggtagtggttatttttaacttnnnnnnn-gacaaagaccaatttgaaactttttaaatcaaaa |
169 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10552169 |
tatgttatttttagagatataagttttttttttttttggtagtggttatttttaacttaaaaaaaagacaaagaccaatttgaaactttttaaatcaaaa |
10552268 |
T |
|
| Q |
170 |
tcaaagatccgattttatcttctttttaagagctaattactgact |
214 |
Q |
| |
|
| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10552269 |
ttaaagatccgattttatcttcattttaagagctaattactgact |
10552313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 270 - 324
Target Start/End: Original strand, 10552370 - 10552424
Alignment:
| Q |
270 |
cgtccaaacttttgatttgtgctttgaatgaattttcgttggaatatttagaata |
324 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10552370 |
cgtccaaacttttgatttctgctttgaatgaattatcgttggaatatttagaata |
10552424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University