View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0959_low_12 (Length: 342)

Name: NF0959_low_12
Description: NF0959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0959_low_12
NF0959_low_12
[»] chr3 (1 HSPs)
chr3 (217-250)||(36259042-36259075)


Alignment Details
Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 217 - 250
Target Start/End: Complemental strand, 36259075 - 36259042
Alignment:
Q  217 cacaacacaaagagccaagaggggggcatgcaag 250  Q
    ||||||||||||||||||||||||||||||||||    
T  36259075 cacaacacaaagagccaagaggggggcatgcaag 36259042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University