View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0959_low_25 (Length: 296)
Name: NF0959_low_25
Description: NF0959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0959_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 29 - 277
Target Start/End: Complemental strand, 31688550 - 31688303
Alignment:
| Q |
29 |
agatctgaaggagatgataaggtggagtgatcttatagaagaaggacgaagaaaacgaatgaggaaagagctacggaaaaagaggcttgtctcttttgtg |
128 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
31688550 |
agatctgaaggag-tgataaggtggagcgatcttatagaagaaggacgaaaaaaacgaatgaggaaagacctacagaaaaagaggcttgtctcttttgtg |
31688452 |
T |
 |
| Q |
129 |
tctgatatgtgaaacactcttgtttcttgnnnnnnnnnnnnattatggctcctgttctatagtatttgatataactatgcagttaactgtttgttaacta |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31688451 |
tctgatatgtgaaacactcttgtttcttgtttttcttttttattatggctcctgttctatagtatttgatataactatgcagttaactgtttgttaacta |
31688352 |
T |
 |
| Q |
229 |
tggtaacactataacaacttttctttattggagcttctcttattctttt |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31688351 |
tggtaacactataacaacttttctttattggagcttctcttattctttt |
31688303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 170 - 252
Target Start/End: Complemental strand, 27649953 - 27649873
Alignment:
| Q |
170 |
attatggctcctgttctatagtatttgatataactatgcagttaactgtttgttaactatggtaacactataacaacttttct |
252 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||| | |||||| ||||||||| || |||||| |
|
|
| T |
27649953 |
attatggctactgttcta--gtatttgatataactaagcagttaactgtttgttgattatggttacactataagaaattttct |
27649873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 247 - 277
Target Start/End: Complemental strand, 36242569 - 36242539
Alignment:
| Q |
247 |
ttttctttattggagcttctcttattctttt |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36242569 |
ttttctttattggagcttctcttattctttt |
36242539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University