View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0959_low_27 (Length: 294)
Name: NF0959_low_27
Description: NF0959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0959_low_27 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 3 - 294
Target Start/End: Complemental strand, 13748299 - 13748008
Alignment:
| Q |
3 |
gatgtcgaagaatatccatctaagacggggaataatcttggcgttgatcacaaagagcaggaaacaacaccagatgatgaaccggattggcggaaaatgt |
102 |
Q |
| |
|
|||||| || || |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13748299 |
gatgtcaaacaagatccatctaagacggggaataatcttggagttgatcacaaagagcaggaaacaacaccagatgatgaaccggattggcggaaaatgt |
13748200 |
T |
 |
| Q |
103 |
ttctggatggaatgcaggatagagaaaaagcacttctaaccgagtacactaatactcttcggaattacaaagatgttaagaagaggctcgccgaaataga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13748199 |
ttctggatggaatgcaggatagagaaaaagcacttctaaccgagtacactaatactcttcggaattacaaagatgttaagaagaggctcgccgaaataga |
13748100 |
T |
 |
| Q |
203 |
ggacaaaaatcaagacaaaaccttggattcttgtttgcaattgcagttaaatgaactgaagacatctaatttcttgaaagatcaagaaataa |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||| |
|
|
| T |
13748099 |
ggacaaaaatcaagacaaaaccttggattcttgtttgcaattgcagttaaatgaactgaagacgtctaattacttgaaagatcaagagataa |
13748008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University