View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0959_low_33 (Length: 227)
Name: NF0959_low_33
Description: NF0959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0959_low_33 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 51761389 - 51761611
Alignment:
Q |
1 |
taaatatgacttagagatcttgactcacttccattccaa-ggcaccaacatttcccttccctataaataaaagccatctccccttactctactcaatcac |
99 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
51761389 |
taaatatgacttagagatcttgactcacttccattccaaaggcaccaacatttcccttccctataaataaaagccatctccccttactctactgaatcac |
51761488 |
T |
 |
Q |
100 |
actcactcttannnnnnnnnnnnnnnnnnnttcctctaatttcttaatccttttgttcttcttttctttgtgatataaacaaaaaatgatgcaaacacat |
199 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51761489 |
actcactctta-----aacacaacacaacattcctctaatttcttaatccttttgttcttcttttctttgtgatataaacaaaaaatgatgcaaacacat |
51761583 |
T |
 |
Q |
200 |
aactccctcacactccttgctttcttca |
227 |
Q |
|
|
|||||||||||||||| ||||||||||| |
|
|
T |
51761584 |
aactccctcacactccatgctttcttca |
51761611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University