View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0959_low_34 (Length: 227)
Name: NF0959_low_34
Description: NF0959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0959_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 2 - 143
Target Start/End: Complemental strand, 44551528 - 44551384
Alignment:
| Q |
2 |
agtatggtgggaatcctattctcctatttatacacttaatttagttatata---ttttgaaactattttttcttttaattgttgagttttattgcaacca |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44551528 |
agtatggtgggaatcctattctcctatttatacacttaatttagttatatactattttgaaactattttttcttttaattgttgagttttactgcaacca |
44551429 |
T |
 |
| Q |
99 |
atgcaaattgtacttgactcaaaaaatgcaaattataatcttcat |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44551428 |
atgcaaattgtacttgactcaaaaaatgcaaattataatcttcat |
44551384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University