View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0959_low_37 (Length: 214)

Name: NF0959_low_37
Description: NF0959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0959_low_37
NF0959_low_37
[»] chr5 (1 HSPs)
chr5 (1-125)||(30100014-30100138)


Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 30100138 - 30100014
Alignment:
1 tgaggttcaacaatacgatcaaccaaaaatatatttaaaatcacctgacgatttcagatccttgagttttgacaatatcttcaagaacttgctcactcaa 100  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||    
30100138 tgaggttcaacaatacgatcaaccaaaaatacatttaaaatcacctgacaatttcagatccttgagttttgacgatatcttcaagaacttgctcactcaa 30100039  T
101 gctaagacgcctaacttgatgatgt 125  Q
    |||||||||||||||||||| ||||    
30100038 gctaagacgcctaacttgatcatgt 30100014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University