View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0959_low_4 (Length: 470)
Name: NF0959_low_4
Description: NF0959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0959_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 101 - 457
Target Start/End: Complemental strand, 28341495 - 28341139
Alignment:
| Q |
101 |
cacagattccaccttctgaatttcctgaatcttggtttcgacaaccatctccggcccacaattcgtatcctttgctgccaaatccggtaaagtctccgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28341495 |
cacagattccaccttctgaatttcctgaatcttggtttcgacaaccatctccggcccacaattcgtatcctttgctgccaaatccggtaaagtctccgga |
28341396 |
T |
 |
| Q |
201 |
catttcacctgactcaactcaggattcgtggttttcgacgacagaggaggtggagatgaatcttccggtggcggaggaggaggtggagttgaatcttcca |
300 |
Q |
| |
|
|||| |||||||||||| ||||||||| ||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28341395 |
cattccacctgactcaaatcaggattcatggttgtcaacgagggaggaggtggagatgaatcttccggtggcggaggaggaggtggagttgaatcttcca |
28341296 |
T |
 |
| Q |
301 |
gtggcggaggagatgaatcttcaaactttggaacgtgaacggaattgagcaactcaaggagactgttaggtcttgaattgtggccgttcctgttgttagc |
400 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||| |||||||||| |
|
|
| T |
28341295 |
ttggcggaggagatgaatcttcaaattttggaacgtgaacggaattgagcaactcaaagagactgtaagatcttgaattgtggccgttcttgttgttagc |
28341196 |
T |
 |
| Q |
401 |
acgaacagggaggaggaagagcctcaaccttaccggctgctttggagaagcgcgaca |
457 |
Q |
| |
|
||||||||||| |||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28341195 |
acgaacagggaagaggaaaagcctcaatcttaccggctgctttggagaagcgcgaca |
28341139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University