View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0959_low_5 (Length: 406)
Name: NF0959_low_5
Description: NF0959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0959_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 2e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 263 - 378
Target Start/End: Original strand, 51491363 - 51491478
Alignment:
| Q |
263 |
cttactaaaaattaagtgatgctccacaaaaaagaaataaataatgttgtatagaatatgatatcgccctcactaaccaattattttggatccatcatta |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51491363 |
cttactaaaaattaagtgatgctccacaaaaaagaaataaataatgttgtatagaatatgatatcgccctcactaaccaatttttttggatccatcatta |
51491462 |
T |
|
| Q |
363 |
gaaggaagaagtatat |
378 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
51491463 |
gaaggaagaagtatat |
51491478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 144 - 217
Target Start/End: Original strand, 51491244 - 51491317
Alignment:
| Q |
144 |
gttaaaatgagtcttataataaagggcaaaagcggggacagatctacattgatcattggggatagctgccccac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51491244 |
gttaaaatgagtcttataataaagggcaaaagcggggacagatctacattgatcattggggatagctgccccac |
51491317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University