View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0960_high_9 (Length: 296)
Name: NF0960_high_9
Description: NF0960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0960_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 12 - 267
Target Start/End: Original strand, 33108670 - 33108925
Alignment:
| Q |
12 |
caatatagcttatttaaagagtttgactttattttattttgttatgtaagtagtttatacattgaccctcatatgactagaacttatactatactataag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
33108670 |
caatatagcttatttaaagagtttgactttattttattttgttatgtaagtagtttatacattgacactcatatgactagaatttatactatactataag |
33108769 |
T |
 |
| Q |
112 |
tacttagttatactgtttatcttaacatggtctatatggaattgcttgcttatatagaaacttacatatttttcttgtgcagtgaaattgtaatcaggta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33108770 |
tacttagttatactgtttatcttaacatggtctatatggaattgcttgcttatatagaaacttacatatttttcttgtgcagtgaaattgtaatcaggta |
33108869 |
T |
 |
| Q |
212 |
acaaagttggtgatggcaggacaactaggagtgcttaatgcactcgatgtggcgaa |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33108870 |
acaaagttggtgatggcaggacaactaggagtgcttaatgcactcgatgtggcgaa |
33108925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University