View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0960_low_12 (Length: 434)
Name: NF0960_low_12
Description: NF0960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0960_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 79 - 306
Target Start/End: Complemental strand, 41705742 - 41705515
Alignment:
| Q |
79 |
agtgagatgaaccgcagtctttggtttcaatggagtctaaagggcaatgagccattgtgcatagatcggaagagggggtggaactgtgtgctacagagca |
178 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705742 |
agtgaaatgaaccgcagtctttggtttcaatggagtctaaagggcaatgagccattgtgcatagatcggaagagggggtggaactgtgtgctacagagca |
41705643 |
T |
|
| Q |
179 |
tgcatgggagttgcatgaaatgggggtgctgtgggagatgttggtagggggagagggatccgaggtaagcttgggttttaattcacagaggatgcagttg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705642 |
tgcatgggagttgcatgaaatgggggtgctgtgggagatgttggtagggggagagggatccgaggtaagcttgggttttaattcacagaggatgcagttg |
41705543 |
T |
|
| Q |
279 |
aacggtgtgcatgggaaccaaacaaggt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41705542 |
aacggtgtgcatgggaaccaaacaaggt |
41705515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University