View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0960_low_20 (Length: 325)
Name: NF0960_low_20
Description: NF0960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0960_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 129 - 258
Target Start/End: Complemental strand, 44310721 - 44310592
Alignment:
| Q |
129 |
ttttggattatgcgcaggctcaaggtgaagagagaaaatagacatgaataaatgttgttgcaagtggactggagtgatacaatctacaaagaaataagta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44310721 |
ttttggattatgcgcaggctcaaggtgaagagagaaaatagacatgaataaatgttgttgcaagtggactggagtgatacaatctacaaagaaataagta |
44310622 |
T |
 |
| Q |
229 |
cattgaacaatactacaatatttgaatgtt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44310621 |
cattgaacaatactacaatatttgaatgtt |
44310592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 14 - 83
Target Start/End: Complemental strand, 44310780 - 44310711
Alignment:
| Q |
14 |
atataaatattgacctacatattagattgccaactaaaaagctttcaactcactgcaatttttggattat |
83 |
Q |
| |
|
|||||||| ||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44310780 |
atataaatgttgacttacatattagattttcaactaaaaagctttcaactcactgcaatttttggattat |
44310711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University