View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0960_low_36 (Length: 233)
Name: NF0960_low_36
Description: NF0960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0960_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 88
Target Start/End: Original strand, 1090754 - 1090813
Alignment:
Q |
29 |
cgaagcttaagaaagttcactattggacgannnnnnnacatcggttttagatggcaaacg |
88 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
T |
1090754 |
cgaagcttaagaaagttcactattggacgatttttttacatcggttttagatagcaaacg |
1090813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University