View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0960_low_40 (Length: 201)
Name: NF0960_low_40
Description: NF0960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0960_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 35710683 - 35710592
Alignment:
Q |
1 |
acattgacatatcatatcacatgcagttggtccaagttattcttttcgtttcatgtcaggttgtattgcataataccagctgctgatgatgt |
92 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35710683 |
acattgacatatcatatcacatgcaattggtccaagttattcttttcgtttcatgtcaggttgtattgcataataccagctgctgatgatgt |
35710592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University